Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22064164

Morpholino Name: adgrl2 MO1
Synonyms:
Target mRNA: adgrl2

Morpholino Type: uncategorized morpholino
Sequence: 5' CCTGCTGCCAGGAGTCACCATTATT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' AATAATGGTGACTCCTGGCAGCAGG 3'
   |||||||||||||||||||||||||
3' TTATTACCACTGAGGACCGTCGTCC 5'
5' AATAATGGTGACTCCTGGCAGCAGG 3'
   |||||||||||||||||||||||||
3' TTATTACCACTGAGGACCGTCGTCC 5'
5' AATAATGGTGACTCCTGGCAGCAGG 3'
   |||||||||||||||||||||||||
3' TTATTACCACTGAGGACCGTCGTCC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:73513119..73513143 25/25 Antisense target adgrl2.L
Chr4S:59654211..59654235 25/25 Antisense target adgrl2.S
Chr7L:100016181..100016205 21/25 unknown
tropicalis 10.0 Chr4:78743530..78743554 25/25 Antisense target adgrl2
Chr3:68219526..68219550 21/25 Sense off-target met
Publications
First: Latrophilin2 is involved in neural crest cell migration and placode patterning in Xenopus laevis., Int J Dev Biol 2019                      
Most recent:
View All Papers