Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22064786

Morpholino Name: ndst1 MO2
Synonyms:
Target mRNA: ndst1

Morpholino Type: uncategorized morpholino
Sequence: 5' AGGAGTGGCACAAGCTCACAAATGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 24/25 24/25
genome
MO
5' GCATTTGTGAGCTTGTGCCATTCCT 3'
   |||||||||||||||||||| ||||
3' CGTAAACACTCGAACACGGTGAGGA 5'
5' GCATTTGTGAGCTTGTGCCATTCCT 3'
   |||||||||||||||||||| ||||
3' CGTAAACACTCGAACACGGTGAGGA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:15502721..15502745 24/25 Antisense target ndst1.S
Chr3L:26764004..26764028 25/25 Antisense off-target LOC108710821
Chr1S:39036924..39036948 21/25 Sense off-target mfap3l.S
tropicalis 10.0 Chr3:21610902..21610926 24/25 Antisense target ndst1
Publications
First: Roles of two types of heparan sulfate clusters in Wnt distribution and signaling in Xenopus., Nat Commun 2017                                                    
Most recent: Ndst1, a heparan sulfate modification enzyme, regulates neuroectodermal patterning by enhancing Wnt signaling in Xenopus., Dev Growth Differ 2023                
View All Papers