Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22064800

Morpholino Name: scp2 MO1
Synonyms:
Target mRNA: scp2

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' AGCCATGTTCCACAGCAGCAGGTAT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' ATACCTGCTGCTGTGGAACATGGCT 3'
   |||||||||||||||||||||||||
3' TATGGACGACGACACCTTGTACCGA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:92334979..92335003 25/25 Antisense target scp2.L
Chr5S:65435700..65435724 21/25 Sense off-target sobp.S
Chr8S:99400396..99400420 21/25 Antisense off-target sema6c.S
Publications
First: Sterol carrier protein 2 regulates proximal tubule size in the Xenopus pronephric kidney by modulating lipid rafts., Dev Biol 2014                                            
Most recent:
View All Papers