Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22166210

Morpholino Name: vangl2 MO7
Synonyms:
Target mRNA: vangl2

Morpholino Type: uncategorized morpholino
Sequence: 5' ACTGGGAATCGTTGTCCATGTTTTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genome
MO
5' GAAAACATGGACAACGACTCCCAGT 3'
   ||||||||||||||||| |||||||
3' CTTTTGTACCTGTTGCTAAGGGTCA 5'
5' GAAAACATGGACAACGATTCCCAGT 3'
   |||||||||||||||||||||||||
3' CTTTTGTACCTGTTGCTAAGGGTCA 5'
5' GAAAACATGGACAATGATTCCCAGT 3'
   |||||||||||||| ||||||||||
3' CTTTTGTACCTGTTGCTAAGGGTCA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:127346503..127346527 25/25 Antisense target vangl2.L
Chr8S:99085596..99085620 24/25 Antisense target vangl2.S
Chr9_10L:96777144..96777168 21/25 unknown
tropicalis 10.0 Chr8:137136566..137136590 24/25 Antisense target vangl2
Chr4:20023460..20023484 21/25 Sense off-target kcna4
Chr4:20064491..20064515 21/25 Sense off-target LOC116410304
Chr4:20080400..20080424 21/25 Sense off-target LOC116410304
Chr8:17057246..17057270 21/25 Sense off-target LOC108648827
Chr4:20099934..20099958 21/25 Sense off-target LOC116410304
Chr4:20117659..20117683 21/25 Sense off-target LOC116410304
Chr4:20157369..20157393 21/25 Sense off-target LOC101732864
Chr4:20176466..20176490 21/25 Sense off-target LOC101732864
Chr4:19547637..19547661 21/25 unknown
Chr8:17421932..17421956 21/25 unknown
Chr4:20144476..20144500 21/25 unknown
Publications
First: Vangl2 coordinates cell rearrangements during gut elongation., Dev Dyn 2019                  
Most recent:
View All Papers