Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22167809

Morpholino Name: h2az1 MO1
Synonyms: H2AFZ MO #1
Target mRNA: h2az1

Morpholino Type: uncategorized morpholino
Sequence: 5' GCACTACAAAAATGTACTTACCACC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 21/25 25/25
genome
MO
5' GGTGGTAAGTACATTTTTCTTGTCG 3'
   |||||||||||||||||| | ||  
3' CCACCATTCATGTAAAAACATCACG 5'
5' GGTGGTAAGTACATTTTTGTAGTGC 3'
   |||||||||||||||||||||||||
3' CCACCATTCATGTAAAAACATCACG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:78945032..78945056 25/25 Antisense target h2az1.L
Chr1S:30886669..30886693 21/25 Sense off-target sgcz.S
Chr5L:107312965..107312989 21/25 unknown
tropicalis 10.0 Chr1:74380046..74380070 21/25 Antisense target h2az1
Chr4:70727587..70727611 21/25 unknown
Publications
First:
Most recent:
View All Papers