Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22167810

Morpholino Name: h2az1 MO2
Synonyms: H2AFZ MO #2
Target mRNA: h2az1

Morpholino Type: uncategorized morpholino
Sequence: 5' ACCACAAAAGTCACTTACCACCACC 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' GGTGGTGGTAAGTGACTTTTGTGGT 3'
   |||||||||||||||||||||||||
3' CCACCACCATTCACTGAAAACACCA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1S:63084196..63084220 25/25 Antisense target h2az1.S
Chr4S:131992362..131992386 21/25 Antisense off-target syn2.S
Chr3S:26805782..26805806 21/25 Antisense off-target ddx56.S
tropicalis 10.0 Chr6:27175633..27175657 22/25 Antisense off-target mllt10
Publications
First: Single Amino Acid Change Underlies Distinct Roles of H2A.Z Subtypes in Human Syndrome., Cell 2019                                  
Most recent:
View All Papers