Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22167811

Morpholino Name: h2az2 MO1
Synonyms: H2AFV MO, H2AFV MO#1
Target mRNA: h2az2

Morpholino Type: uncategorized morpholino
Sequence: 5' ACAGGGAACTAAGAGGTACAAAGGA 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' TCCTTTGTACCTCTTAGTTCCCTGT 3'
   |||||||||||||||||||||||||
3' AGGAAACATGGAGAATCAAGGGACA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:27806082..27806106 25/25 Antisense target h2az2.S
Chr3S:27806082..27806106 25/25 Sense off-target polm.S
Chr3L:133267005..133267029 25/25 Antisense off-target MGC85536
Chr6L:79775441..79775465 21/25 Sense off-target ube2ql1.L
Chr4S:58319499..58319523 21/25 unknown
tropicalis 10.0 Chr3:77674356..77674380 21/25 Sense off-target reln
Chr4:39857541..39857565 21/25 unknown
Publications
First: Single Amino Acid Change Underlies Distinct Roles of H2A.Z Subtypes in Human Syndrome., Cell 2019                                  
Most recent:
View All Papers