Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22169242

Morpholino Name: sfrpx MO1
Synonyms:
Target mRNA: sfrpx

Morpholino Type: uncategorized morpholino
Sequence: 5' TCTTAATGGGCAGCTCTTCATTTAA 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 24/25 25/25
genome
MO
5' TTAAATAAAGAGCTGCCCATTAAGA 3'
   |||||| ||||||||||||||||||
3' AATTTACTTCTCGACGGGTAATTCT 5'
5' TTAAATGAAGAGCTGCCCATTAAGA 3'
   |||||||||||||||||||||||||
3' AATTTACTTCTCGACGGGTAATTCT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2S:168229445..168229469 25/25 Sense target sfrpx.S
Chr2L:179791328..179791352 24/25 Sense target sfrpx.L
Chr9_10L:122566409..122566433 21/25 Antisense off-target LOC108701685
tropicalis 10.0 Chr4:85682609..85682633 21/25 Antisense off-target patj
Publications
First: Bioinformatics Screening of Genes Specific for Well-Regenerating Vertebrates Reveals c-answer, a Regulator of Brain Development and Regeneration., Cell Rep 2019                                
Most recent:
View All Papers