Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22169651

Morpholino Name: vldlr cMO1
Synonyms:
Target mRNA: vldlr

Morpholino Type: control morpholino
Sequence: 5' GATGGGAGTGTGATGGAGAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 20/20 20/20 20/20
genome
MO
5' GTCTCCATCACACTCCCATC 3'
   ||||||||||||||||||||
3' CAGAGGTAGTGTGAGGGTAG 5'
5' GTCTCCATCACACTCCCATC 3'
   ||||||||||||||||||||
3' CAGAGGTAGTGTGAGGGTAG 5'
5' GTCTCCATCACACTCCCATC 3'
   ||||||||||||||||||||
3' CAGAGGTAGTGTGAGGGTAG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:138754179..138754198 20/20 Sense target vldlr.L
Chr1S:118208727..118208746 20/20 Sense target vldlr.S
Chr9_10S:7980917..7980936 19/20 Antisense off-target ada.S
Chr9_10S:7981062..7981081 19/20 Antisense off-target ada.S
Chr4S:27164642..27164661 18/20 Antisense off-target LOC108715348
Chr3L:101089261..101089280 17/20 Sense off-target LOC108711340
Chr5S:49210188..49210207 17/20 Sense off-target LOC108717885
Chr3S:44388932..44388951 16/20 Antisense off-target LOC108712842
Chr2L:185413423..185413442 19/20 unknown
Chr2L:185413555..185413574 19/20 unknown
Chr4L:152816720..152816739 19/20 unknown
Chr4S:113491048..113491067 19/20 unknown
Chr1S:5799417..5799436 18/20 unknown
Chr1S:7069170..7069189 18/20 unknown
Chr3S:131082352..131082371 18/20 unknown
Chr4S:113490868..113490887 18/20 unknown
Chr5S:107263488..107263507 18/20 unknown
Chr6L:141494262..141494281 17/20 unknown
Chr2S:19382803..19382822 16/20 unknown
Chr4S:17013209..17013228 16/20 unknown
Chr6S:91895400..91895419 16/20 unknown
Chr7L:67307926..67307945 16/20 unknown
tropicalis 10.0 Chr1:128081143..128081162 20/20 Sense target vldlr
Chr6:16055842..16055861 19/20 Sense off-target dpp6
Chr8:72077031..72077050 17/20 Sense off-target wdr46
Chr5:58932370..58932389 17/20 Sense off-target map3k5
Chr2:3732756..3732775 18/20 unknown
Publications
First: The VLDL receptor regulates membrane progesterone receptor trafficking and non-genomic signaling., J Cell Sci 2018                  
Most recent:
View All Papers