Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22194200

Morpholino Name: emc1 MO1
Synonyms:
Target mRNA: emc1

Morpholino Type: uncategorized morpholino
Sequence: 5' ATGCCTTTGCTCAATTTGTTTCTGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 23/25
genome
MO
5' CCACAAGCAAATTGAGCAAAGGCAT 3'
   ||| || ||||||||||||||||||
3' GGTCTTTGTTTAACTCGTTTCCGTA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10S:17465902..17465926 22/25 Antisense off-target LOC108702671
Chr3L:75600276..75600300 21/25 unknown
Chr3L:97368498..97368522 21/25 unknown
Chr5L:8641117..8641141 21/25 unknown
Chr6L:138062484..138062508 21/25 unknown
Chr9_10L:38867798..38867822 21/25 unknown
tropicalis 10.0 Chr7:130156348..130156372 23/25 Antisense target emc1
Chr2:105262881..105262905 21/25 unknown
Chr4:83137856..83137880 21/25 unknown
Chr8:94490061..94490085 21/25 unknown
Publications
First: Disrupted ER membrane protein complex-mediated topogenesis drives congenital neural crest defects., J Clin Invest 2020                                  
Most recent:
View All Papers