Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22194337

Morpholino Name: ncbp2 MO1
Synonyms:
Target mRNA: ncbp2

Morpholino Type: splice blocking morpholino (I1-E2)
Sequence: 5' CGGTTTCCCTAGAATAGAAACAGGT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' ACCTGTTTCTATTCTAGGGAAACCG 3'
   |||||||||||||||||||||||||
3' TGGACAAAGATAAGATCCCTTTGGC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:112901133..112901157 25/25 Antisense target ncbp2.L
Chr4S:127462918..127462942 21/25 Antisense off-target slmap.S
tropicalis 10.0 Chr1:189445728..189445752 21/25 Antisense off-target elovl7
Chr2:57237093..57237117 21/25 unknown
Publications
First: NCBP2 modulates neurodevelopmental defects of the 3q29 deletion in Drosophila and Xenopus laevis models., PLoS Genet 2020                          
Most recent:
View All Papers