Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22201075

Morpholino Name: Sall1 MO
Synonyms:
Target mRNA: sall1

Morpholino Type: uncategorized morpholino
Sequence: 5' GCATGTCTCGGAGGAAGCAGCGAAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 22/25 22/25
genome
MO
5' TTCGCCTGCTTCCTCCGAGACATGC 3'
   ||   ||||||||||||||||||||
3' AAAGCGACGAAGGAGGCTCTGTACG 5'
5' TTCGCCTGCTTCCTCCGAGACATGC 3'
   ||   ||||||||||||||||||||
3' AAAGCGACGAAGGAGGCTCTGTACG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:43185226..43185250 22/25 Sense target sall1.L
Chr4S:32112219..32112243 23/25 Sense off-target LOC108715370
Chr6L:143060571..143060595 21/25 Sense off-target zfpm2.L
tropicalis 10.0 Chr4:50886273..50886297 22/25 Sense target sall1
Chr4:50886273..50886297 22/25 Antisense off-target LOC116410390
Chr9:12083366..12083390 21/25 unknown
Publications
First: Isl1 Regulation of Nkx2.1 in the Early Foregut Epithelium Is Required for Trachea-Esophageal Separation and Lung Lobation., Dev Cell 2019            
Most recent:
View All Papers