Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22251699

Morpholino Name: adprhl1 MO10
Synonyms: Adprhl1-ATGM05(S5)
Target mRNA: adprhl1

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' AGTATCTCATCCCAATACACATGGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25 25/25
genome
MO
5' GCCATGTGTATTGGGATGAAATACT 3'
   ||||||||||||||||||| |||||
3' CGGTACACATAACCCTACTCTATGA 5'
5' GCCATGTGTATTGGGATGAAATACT 3'
   ||||||||||||||||||| |||||
3' CGGTACACATAACCCTACTCTATGA 5'
5' GCCATGTGTATTGGGATGAGATACT 3'
   |||||||||||||||||||||||||
3' CGGTACACATAACCCTACTCTATGA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2S:106629290..106629314 25/25 Antisense target adprhl1.S
Chr2L:120473830..120473854 24/25 Antisense target adprhl1.L
Chr6L:75988398..75988422 21/25 Antisense off-target dnah5.L
Chr5L:159583867..159583891 21/25 Antisense off-target supt3h.L
Chr2L:44606515..44606539 21/25 unknown
tropicalis 10.0 Chr2:115903804..115903828 24/25 Antisense target adprhl1
Chr3:102386342..102386366 21/25 Antisense off-target tmod2
Chr8:34081923..34081947 21/25 Sense off-target astn2
Chr1:203253627..203253651 21/25 Antisense off-target rab27b
Publications
First: Defective heart chamber growth and myofibrillogenesis after knockout of adprhl1 gene function by targeted disruption of the ancestral catalytic active site., PLoS One 2020                                              
Most recent:
View All Papers