Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22251700

Morpholino Name: adprhl1 MO11
Synonyms: Adprhl1-ATGM05(L5)
Target mRNA: adprhl1

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' AGTATTTCATCCCAATACACATGGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genome
MO
5' GCCATGTGTATTGGGATGAAATACT 3'
   |||||||||||||||||||||||||
3' CGGTACACATAACCCTACTTTATGA 5'
5' GCCATGTGTATTGGGATGAAATACT 3'
   |||||||||||||||||||||||||
3' CGGTACACATAACCCTACTTTATGA 5'
5' GCCATGTGTATTGGGATGAGATACT 3'
   ||||||||||||||||||| |||||
3' CGGTACACATAACCCTACTTTATGA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:120473830..120473854 25/25 Antisense target adprhl1.L
Chr2S:106629290..106629314 24/25 Antisense target adprhl1.S
Chr7L:39659532..39659556 21/25 Sense off-target lrrc20.L
Chr1L:89862799..89862823 21/25 unknown
tropicalis 10.0 Chr2:115903804..115903828 25/25 Antisense target adprhl1
Publications
First: Defective heart chamber growth and myofibrillogenesis after knockout of adprhl1 gene function by targeted disruption of the ancestral catalytic active site., PLoS One 2020                                              
Most recent:
View All Papers