Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22251702

Morpholino Name: adprhl1 MO13
Synonyms: Adprhl1-ATGM06(L6)
Target mRNA: adprhl1

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GATGGTTATGCGTCATTCTCCCACT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 24/25
genome
MO
5' AGTGGGAGAATGACTCATAATCATC 3'
   |||||||||||||| ||||| ||||
3' TCACCCTCTTACTGCGTATTGGTAG 5'
5' AGTGGGAGAATGACGCATAACCATC 3'
   |||||||||||||||||||||||||
3' TCACCCTCTTACTGCGTATTGGTAG 5'
5' AGTGGGAGAATGACTCATAACCATC 3'
   |||||||||||||| ||||||||||
3' TCACCCTCTTACTGCGTATTGGTAG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:120473899..120473923 25/25 Antisense target adprhl1.L
Chr2S:106629359..106629383 24/25 Antisense target adprhl1.S
tropicalis 10.0 Chr2:115903873..115903897 23/25 Antisense target adprhl1
Chr10:19939861..19939885 21/25 unknown
Publications
First: Defective heart chamber growth and myofibrillogenesis after knockout of adprhl1 gene function by targeted disruption of the ancestral catalytic active site., PLoS One 2020                                              
Most recent:
View All Papers