Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22252009

Morpholino Name: usp8 MO1
Synonyms: Usp8 MO
Target mRNA: usp8

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTGCAAATTCTCCTCTCTTATCAA 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' TTGATAAGAGAGGAGAATTTGCAGC 3'
   |||||||||||||||||||||||||
3' AACTATTCTCTCCTCTTAAACGTCG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:110554408..110554432 25/25 Antisense target usp8.L
Chr4S:102375722..102375746 21/25 unknown
tropicalis 10.0 Chr5:54784138..54784162 22/25 unknown
Publications
First: TMEM79/MATTRIN defines a pathway for Frizzled regulation and is required for Xenopus embryogenesis., Elife 2020                                                                                            
Most recent:
View All Papers