Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-23619058

Morpholino Name: nelfa MO1
Synonyms: LOC108706516, whsc2 MO
Target mRNA: nelfa

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' TGTCACTATCCCTCATAGACGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 24/25
genome
MO
5' ATGGCGTCTATGAGGGAGAGTGACA 3'
   ||||||||||||||||| |||||||
3' TACCGCAGATACTCCCTATCACTGT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1S:12550600..12550624 25/25 Antisense off-target LOC108706516
Chr2L:15328522..15328546 21/25 Sense off-target tiam1.L
tropicalis 10.0 Chr1:21143218..21143242 24/25 Antisense target nelfa
Publications
First: Wolf-Hirschhorn Syndrome-Associated Genes Are Enriched in Motile Neural Crest Cells and Affect Craniofacial Development in Xenopus laevis., Front Physiol 2019                                            
Most recent:
View All Papers