Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-23622622

Morpholino Name: uxt MO1
Synonyms:
Target mRNA: uxt

Morpholino Type: uncategorized morpholino
Sequence: 5' CCCAGCCCCGCCATCCCTTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 20/20
genome
MO
5' GAAGGGATGGCGGGGCTGGG 3'
   ||||||||||||||||||||
3' CTTCCCTACCGCCCCGACCC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:26877540..26877559 18/20 Antisense off-target ogdh.S
Chr3S:26877606..26877625 18/20 Antisense off-target ogdh.S
Chr3S:26877639..26877658 18/20 Antisense off-target ogdh.S
Chr2S:56787164..56787183 16/20 Antisense off-target LOC108708909
Chr2S:8009971..8009990 18/20 unknown
tropicalis 10.0 Chr8:1335517..1335536 20/20 Antisense target uxt
Chr8:1335517..1335536 20/20 Sense off-target tmem111
Chr6:151311774..151311793 16/20 Antisense off-target exosc4
Chr4:145370910..145370929 18/20 unknown
Chr2:161738238..161738257 17/20 unknown
Chr5:162982095..162982114 16/20 unknown
Publications
First: UXT chaperone prevents proteotoxicity by acting as an autophagy adaptor for p62-dependent aggrephagy., Nat Commun 2021                  
Most recent:
View All Papers