Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-23622629

Morpholino Name: uqcrc2 MO1
Synonyms: uqcrc2.L MO
Target mRNA: uqcrc2

Morpholino Type: splice blocking morpholino
Sequence: 5' ACAGTGTCTCTAAAGCACAGATACA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 21/25 25/25
genome
MO
5' CATTTATGTGCTTTAGAGACACTGT 3'
     | | |||||||||||||||||||
3' ACATAGACACGAAATCTCTGTGACA 5'
5' TGTATCTGTGCTTTAGAGACACTGT 3'
   |||||||||||||||||||||||||
3' ACATAGACACGAAATCTCTGTGACA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:111658111..111658135 25/25 Antisense target uqcrc2.L
Chr2S:140915906..140915930 22/25 Antisense off-target LOC100127287
Chr3L:151038284..151038308 21/25 unknown
tropicalis 10.0 Chr9:24847073..24847097 21/25 Antisense target uqcrc2
Chr1:119708668..119708692 22/25 Sense off-target focad
Chr1:119708668..119708692 22/25 Antisense off-target mllt3
Chr8:92635711..92635735 21/25 Sense off-target fancm
Chr8:92635711..92635735 21/25 Antisense off-target LOC100493841
Publications
First: Functional assessment of the "two-hit" model for neurodevelopmental defects in Drosophila and X. laevis., PLoS Genet 2021                      
Most recent: 16p12.1 Deletion Orthologs are Expressed in Motile Neural Crest Cells and are Important for Regulating Craniofacial Development in Xenopus laevis., Front Genet 2022                          
View All Papers