Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-23659728

Morpholino Name: bicc1 MO3
Synonyms: bicc1-SPMO1 L, bicc1.L MO
Target mRNA: bicc1

Morpholino Type: splice blocking morpholino
Sequence: 5' GGGAATAGACTCACCCTGTAACATT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' AATGTTACAGGGTGAGTCTATTCCC 3'
   |||||||||||||||||||||||||
3' TTACAATGTCCCACTCAGATAAGGG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:10391819..10391843 25/25 Antisense target bicc1.L
Chr6L:89058157..89058181 21/25 unknown
Chr7L:86195215..86195239 21/25 unknown
tropicalis 10.0 Chr3:9638579..9638603 21/25 Antisense off-target erc1
Chr7:109672888..109672912 21/25 unknown
Publications
First: Bicc1 and Dicer regulate left-right patterning through post-transcriptional control of the Nodal inhibitor Dand5., Nat Commun 2021                                
Most recent:
View All Papers