Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-23659729

Morpholino Name: bicc1 MO4
Synonyms: bicc1-SPMO2 S, bicc1.S MO
Target mRNA: bicc1

Morpholino Type: splice blocking morpholino
Sequence: 5' CCCAACAAGCAAGCTCTTACCTTCT 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' AGAAGGTAAGAGCTTGCTTGTTGGG 3'
   |||||||||||||||||||||||||
3' TCTTCCATTCTCGAACGAACAACCC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7S:7701640..7701664 25/25 Antisense target bicc1.S
Chr9_10L:100839589..100839613 22/25 unknown
Publications
First: Bicc1 and Dicer regulate left-right patterning through post-transcriptional control of the Nodal inhibitor Dand5., Nat Commun 2021                                
Most recent:
View All Papers