Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-25874771

Morpholino Name: ubtf MO1
Synonyms:
Target mRNA: ubtf

Morpholino Type: uncategorized morpholino
Sequence: 5' CCAGTGTAGGATGAACGGAGCAGCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 23/25 25/25
genome
MO
5' AGCTGCTCCGTTCATCCTATGCTGG 3'
   |||||||||||||||||||  ||||
3' TCGACGAGGCAAGTAGGATGTGACC 5'
5' AGCTGCTCCGTTCATCCTACACTGG 3'
   |||||||||||||||||||||||||
3' TCGACGAGGCAAGTAGGATGTGACC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:5184644..5184668 25/25 Sense target ubtf.L
Chr3S:1184755..1184779 21/25 Sense off-target krasl.S
Chr3S:74594693..74594717 21/25 Sense off-target gtse1.S
tropicalis 10.0 Chr10:18521677..18521701 23/25 Sense target ubtf
Publications
First: Systematic mapping of rRNA 2'-O methylation during frog development and involvement of the methyltransferase Fibrillarin in eye and craniofacial development in Xenopus laevis., PLoS Genet 2022                                                                
Most recent:
View All Papers