Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-25874772

Morpholino Name: ncl MO1
Synonyms: nucleolin MO
Target mRNA: ncl

Morpholino Type: uncategorized morpholino
Sequence: 5' ACACCGGCCATCATGGTGAAACTAG 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 23/26 25/26
genome
MO
5' CTAGTTTCACCATGGTAGCCGGTGT 3'
   |||||||||||||| | ||||||||
3' GATCAAAGTGGTACTACCGGCCACA 5'
5' CTAGTTTCACCATGATGGCCGGTGT 3'
   |||||||||||||||||||||||||
3' GATCAAAGTGGTACTACCGGCCACA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5S:87593003..87593027 25/25 Sense target ncl.S
Chr5L:107250976..107251000 23/25 Sense target ncl.L
Chr7L:106064784..106064808 21/25 Sense off-target tp73.L
tropicalis 10.0 Chr7:92497239..92497263 21/25 Antisense off-target tmem240
Publications
First: Systematic mapping of rRNA 2'-O methylation during frog development and involvement of the methyltransferase Fibrillarin in eye and craniofacial development in Xenopus laevis., PLoS Genet 2022                                                                
Most recent:
View All Papers