Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-25900471

Morpholino Name: bop1 MO1
Synonyms:
Target mRNA: bop1

Morpholino Type: uncategorized morpholino
Sequence: 5' CCCGAGCCCUGAGUGAGACAUGAA 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 21/24
genome
MO
5' TTCATGTCTCACTCAGGGCTCGGG 3'
   ||| |||||| ||| |||||||||
3' AAGUACAGAGUGAGUCCCGAGCCC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6S:136062234..136062257 21/24 Sense target bop1.S
Publications
First: Functions of block of proliferation 1 during anterior development in Xenopus laevis., PLoS One 2022                          
Most recent:
View All Papers