Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-29208964

Morpholino Name: bap1 MO1
Synonyms: Bap1MO, Bap1MO (5'-UTR) morpholino
Target mRNA: bap1

Morpholino Type: translation blocking morpholino
Sequence: 5' AGCCTTTATTCATGTTGCCTCCTCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25 24/25
genome
MO
5' GGATATGGCAACATGAATAAAGGCT 3'
   |||   |||||||||||||||||||
3' CCTCCTCCGTTGTACTTATTTCCGA 5'
5' GGAGGAGGCAACATGAATAAAGGCT 3'
   |||||||||||||||||||||||||
3' CCTCCTCCGTTGTACTTATTTCCGA 5'
5' GGAGGCGGCAACATGAATAAAGGCT 3'
   ||||| |||||||||||||||||||
3' CCTCCTCCGTTGTACTTATTTCCGA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:127206111..127206135 25/25 Antisense target bap1.L
Chr4S:107194565..107194589 24/25 Antisense target bap1.S
Chr2L:58334467..58334491 21/25 unknown
tropicalis 10.0 Chr4:128143802..128143826 22/25 Antisense target bap1
Chr2:80166173..80166197 21/25 unknown
Publications
First: BAP1 regulates epigenetic switch from pluripotency to differentiation in developmental lineages giving rise to BAP1-mutant cancers., Sci Adv 2019          
Most recent:
View All Papers