Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-29208965

Morpholino Name: bap1 cMO1
Synonyms: Bap1MO-Ctrl
Target mRNA: bap1

Morpholino Type: control morpholino (ATG)
Sequence: 5' AGCTTTCGTTCATGTAACCTCCTCA 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
tropicalis 10.0 Chr1:1535886..1535910 21/25 unknown
Chr1:1536703..1536727 21/25 unknown
Publications
First: BAP1 regulates epigenetic switch from pluripotency to differentiation in developmental lineages giving rise to BAP1-mutant cancers., Sci Adv 2019          
Most recent:
View All Papers