Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-29208966

Morpholino Name: bap1 MO2
Synonyms: Bap1MO (ORF) morpholino
Target mRNA: bap1

Morpholino Type: translation blocking morpholino (ORF)
Sequence: 5' CCAGCTCTAACCAGCCTTTATTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genome
MO
5' ATGAATAAAGGCTGGCTAGAGCTGG 3'
   ||||||||||||||| |||||||||
3' TACTTATTTCCGACCAATCTCGACC 5'
5' ATGAATAAAGGCTGGTTAGAGCTGG 3'
   |||||||||||||||||||||||||
3' TACTTATTTCCGACCAATCTCGACC 5'
5' ATGAATAAAGGCTGGTTAGAGCTGG 3'
   |||||||||||||||||||||||||
3' TACTTATTTCCGACCAATCTCGACC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:127206123..127206147 25/25 Antisense target bap1.L
Chr4S:107194577..107194601 25/25 Antisense target bap1.S
Chr1S:189635862..189635886 22/25 Antisense off-target alpk2.S
Chr4L:91358856..91358880 22/25 Sense off-target rnf11.L
Chr1L:219183936..219183960 21/25 Antisense off-target alpk2.L
Chr7S:13723618..13723642 21/25 unknown
tropicalis 10.0 Chr4:128143814..128143838 24/25 Antisense target bap1
Chr3:71463450..71463474 22/25 Antisense off-target plxnb2
Publications
First: BAP1 regulates epigenetic switch from pluripotency to differentiation in developmental lineages giving rise to BAP1-mutant cancers., Sci Adv 2019          
Most recent:
View All Papers