Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-29208969

Morpholino Name: bmi1 MO1
Synonyms: BMI1B morpholino
Target mRNA: bmi1

Morpholino Type: translation blocking morpholino
Sequence: 5' TTTTAATCCTGGTCGTCCGATGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genome
MO
5' ATGCATCGGACCACCAGGATTAAAA 3'
   ||||||||||| |||||||||||||
3' TACGTAGCCTGCTGGTCCTAATTTT 5'
5' ATGCATCGGACGACCAGGATTAAAA 3'
   |||||||||||||||||||||||||
3' TACGTAGCCTGCTGGTCCTAATTTT 5'
5' ATGCATCGGACCACCAGGATTAAAA 3'
   ||||||||||| |||||||||||||
3' TACGTAGCCTGCTGGTCCTAATTTT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:26233537..26233561 25/25 Antisense target bmi1.L
Chr6S:19763157..19763181 24/25 Antisense target bmi1.S
tropicalis 10.0 Chr6:26841063..26841087 24/25 Antisense target bmi1
Publications
First: BAP1 regulates epigenetic switch from pluripotency to differentiation in developmental lineages giving rise to BAP1-mutant cancers., Sci Adv 2019          
Most recent:
View All Papers