Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-29208971

Morpholino Name: hdac4 MO1
Synonyms: HDAC4.S morpholino
Target mRNA: hdac4

Morpholino Type: translation blocking morpholino
Sequence: 5' GCCACGATAATTCCACTAGCAATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/24 22/24 24/24
genome
MO
5' CATTGCTAGTGGAGTTATTGTGGC 3'
    |||||||||||| |||| |||||
3' CTAACGATCACCTTAATAGCACCG 5'
5' GATTGCTAGTGGAATTGTTGTGGC 3'
   |||||||||||||||| | |||||
3' CTAACGATCACCTTAATAGCACCG 5'
5' GATTGCTAGTGGAATTATCGTGGC 3'
   ||||||||||||||||||||||||
3' CTAACGATCACCTTAATAGCACCG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10S:72283727..72283750 24/24 Antisense target hdac4.S
Chr9_10L:82353404..82353427 22/24 Antisense target hdac4.L
tropicalis 10.0 Chr9:60851109..60851132 21/24 Antisense target hdac4
Chr6:43526894..43526917 20/24 Antisense off-target wipf3
Chr8:63630509..63630532 20/24 unknown
Publications
First: BAP1 regulates epigenetic switch from pluripotency to differentiation in developmental lineages giving rise to BAP1-mutant cancers., Sci Adv 2019          
Most recent:
View All Papers