Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-29208972

Morpholino Name: hdac4 MO2
Synonyms: HDAC4.L morpholino
Target mRNA: hdac4

Morpholino Type: translation blocking morpholino
Sequence: 5' CCAACTGCATAGCAAGTCTGTGG 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 23/23
genome
MO
5' CCACAGACTTGCTATGCAGTTGG 3'
   |||||||||||||||||||||||
3' GGTGTCTGAACGATACGTCAACC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:82386063..82386085 23/23 Antisense target hdac4.L
Chr5S:60585353..60585375 19/23 Sense off-target pde7b.S
Chr1L:38800862..38800884 19/23 Antisense off-target atp8a1.L
Chr3L:94920873..94920895 19/23 Sense off-target ppp6r2.L
Chr5L:63294155..63294177 21/23 unknown
Chr5L:63294678..63294700 21/23 unknown
Chr6L:78580618..78580640 21/23 unknown
Chr6L:78584794..78584816 21/23 unknown
Chr6L:78615697..78615719 20/23 unknown
Chr6L:78615871..78615893 20/23 unknown
Chr6L:78616395..78616417 20/23 unknown
Chr6L:78616569..78616591 20/23 unknown
Chr6L:78616744..78616766 20/23 unknown
Chr6L:78617092..78617114 20/23 unknown
Chr6L:78617787..78617809 20/23 unknown
Chr6L:78618310..78618332 20/23 unknown
Chr6L:78618484..78618506 20/23 unknown
Chr6L:78618658..78618680 20/23 unknown
Chr6L:78618832..78618854 20/23 unknown
Chr6L:78619180..78619202 20/23 unknown
Chr6L:78620258..78620280 20/23 unknown
Chr6L:78620955..78620977 20/23 unknown
Chr6L:78621129..78621151 20/23 unknown
Chr6L:78621689..78621711 20/23 unknown
Chr6L:78633541..78633563 20/23 unknown
Chr6L:78633715..78633737 20/23 unknown
Chr6L:78634064..78634086 20/23 unknown
Chr7L:58248764..58248786 20/23 unknown
Chr7L:58252755..58252777 20/23 unknown
Chr7L:58253453..58253475 20/23 unknown
Chr7L:58254916..58254938 20/23 unknown
Chr7L:58255612..58255634 20/23 unknown
Chr7L:58256122..58256144 20/23 unknown
Chr7L:58257165..58257187 20/23 unknown
Chr7L:58262570..58262592 20/23 unknown
Chr7L:58262744..58262766 20/23 unknown
Chr7L:58264675..58264697 20/23 unknown
Chr7L:58265713..58265735 20/23 unknown
Chr7L:58266235..58266257 20/23 unknown
Chr7L:58266935..58266957 20/23 unknown
Chr6L:78620606..78620628 20/23 unknown
Chr7L:58269006..58269028 20/23 unknown
Chr7L:58269702..58269724 20/23 unknown
Chr7L:58270896..58270918 20/23 unknown
Chr7L:58271070..58271092 20/23 unknown
Chr9_10S:25134174..25134196 20/23 unknown
Chr9_10S:25134980..25135002 20/23 unknown
Chr9_10S:25136291..25136313 20/23 unknown
Chr9_10S:25136986..25137008 20/23 unknown
Chr9_10S:25137331..25137353 20/23 unknown
Chr9_10S:25140367..25140389 20/23 unknown
Chr9_10S:25140953..25140975 20/23 unknown
Chr9_10S:25145118..25145140 20/23 unknown
Chr9_10S:25145639..25145661 20/23 unknown
Chr9_10S:25146307..25146329 20/23 unknown
Chr9_10S:25146829..25146851 20/23 unknown
Chr9_10S:25147352..25147374 20/23 unknown
Chr9_10S:25147860..25147882 20/23 unknown
Chr9_10S:25148383..25148405 20/23 unknown
Chr7L:58267624..58267646 20/23 unknown
Chr1L:96649811..96649833 20/23 unknown
Chr1L:96650164..96650186 20/23 unknown
Chr1L:96654644..96654666 20/23 unknown
Chr3L:19142457..19142479 20/23 unknown
Chr3L:19150974..19150996 20/23 unknown
Chr3L:19151148..19151170 20/23 unknown
Chr3L:19151845..19151867 20/23 unknown
Chr3L:19182469..19182491 20/23 unknown
Chr3L:19182816..19182838 20/23 unknown
Chr3L:19185076..19185098 20/23 unknown
Chr3L:19185423..19185445 20/23 unknown
Chr3L:19185944..19185966 20/23 unknown
Chr3L:19186466..19186488 20/23 unknown
Chr3L:19186814..19186836 20/23 unknown
Chr3L:19187508..19187530 20/23 unknown
Chr3L:19188029..19188051 20/23 unknown
Chr3L:19188724..19188746 20/23 unknown
Chr3L:19188898..19188920 20/23 unknown
Chr3L:19189245..19189267 20/23 unknown
Chr3L:19189592..19189614 20/23 unknown
Chr3L:19190460..19190482 20/23 unknown
Chr3L:19190969..19190991 20/23 unknown
Chr3L:19192185..19192207 20/23 unknown
Chr3L:19192359..19192381 20/23 unknown
Chr3L:19192881..19192903 20/23 unknown
Chr3L:19193576..19193598 20/23 unknown
Chr3L:19194444..19194466 20/23 unknown
Chr3L:19194618..19194640 20/23 unknown
Chr3L:19195313..19195335 20/23 unknown
Chr3L:19195486..19195508 20/23 unknown
Chr3L:19199481..19199503 20/23 unknown
Chr3L:19201046..19201068 20/23 unknown
Chr3L:19211040..19211062 20/23 unknown
Chr3L:19212609..19212631 20/23 unknown
Chr3L:19217336..19217358 20/23 unknown
Chr3L:19217680..19217702 20/23 unknown
Chr3L:19237260..19237282 20/23 unknown
Chr3L:19237600..19237622 20/23 unknown
Chr3L:19238296..19238318 20/23 unknown
Chr5L:63293980..63294002 20/23 unknown
Chr6L:78579400..78579422 20/23 unknown
Chr6L:78580270..78580292 20/23 unknown
Chr6L:78580792..78580814 20/23 unknown
Chr6L:78581140..78581162 20/23 unknown
Chr6L:78581662..78581684 20/23 unknown
Chr6L:78582184..78582206 20/23 unknown
Chr6L:78583402..78583424 20/23 unknown
Chr6L:78591811..78591833 20/23 unknown
Chr6L:78591986..78592008 20/23 unknown
Chr6L:78592508..78592530 20/23 unknown
Chr6L:78606981..78607003 20/23 unknown
Chr6L:78607500..78607522 20/23 unknown
Chr6L:78607674..78607696 20/23 unknown
Chr6L:78607849..78607871 20/23 unknown
Chr6L:78608197..78608219 20/23 unknown
Chr6L:78608371..78608393 20/23 unknown
Chr6L:78608544..78608566 20/23 unknown
Chr6L:78608718..78608740 20/23 unknown
Chr6L:78609241..78609263 20/23 unknown
Chr6L:78609413..78609435 20/23 unknown
Chr6L:78609936..78609958 20/23 unknown
Chr6L:78610654..78610676 20/23 unknown
Chr6L:78611175..78611197 20/23 unknown
Chr6L:78611522..78611544 20/23 unknown
Chr6L:78611870..78611892 20/23 unknown
Chr6L:78612218..78612240 20/23 unknown
Chr6L:78612392..78612414 20/23 unknown
Chr6L:78612566..78612588 20/23 unknown
Chr6L:78612740..78612762 20/23 unknown
Chr6L:78613261..78613283 20/23 unknown
Chr6L:78613609..78613631 20/23 unknown
Chr6L:78613957..78613979 20/23 unknown
Chr6L:78614131..78614153 20/23 unknown
Chr6L:78614479..78614501 20/23 unknown
Chr6L:78614827..78614849 20/23 unknown
Chr6L:78615523..78615545 20/23 unknown
Chr6L:78619912..78619934 19/23 unknown
Chr6L:78622035..78622057 19/23 unknown
Chr9_10S:25137433..25137455 19/23 unknown
Chr6L:133142847..133142869 19/23 unknown
tropicalis 10.0 Chr6:128199471..128199493 21/23 Sense off-target rnf19a
Chr5:7474813..7474835 21/23 Sense off-target LOC101735255
Chr1:121875428..121875450 19/23 unknown
Publications
First: BAP1 regulates epigenetic switch from pluripotency to differentiation in developmental lineages giving rise to BAP1-mutant cancers., Sci Adv 2019          
Most recent:
View All Papers