Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-29209009

Morpholino Name: adam11 MO1
Synonyms: MO11
Target mRNA: adam11

Morpholino Type: translation blocking morpholino
Sequence: 5' CATCATTCATACATAATCATTCAGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' GCTGAATGATTATGTATGAATGATG 3'
   |||||||||||||||||||||||||
3' CGACTTACTAATACATACTTACTAC 5'
5' GCTGAATGATTATGTATGAATGATG 3'
   |||||||||||||||||||||||||
3' CGACTTACTAATACATACTTACTAC 5'
5' GCTGAATGATTATGTATGAATGATG 3'
   |||||||||||||||||||||||||
3' CGACTTACTAATACATACTTACTAC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:5541225..5541249 25/25 Antisense target adam11.L
Chr9_10S:5235699..5235723 25/25 Antisense target adam11.S
Chr6S:3470609..3470633 21/25 Sense off-target map4.S
Chr9_10L:84607645..84607669 21/25 Sense off-target vwc2l.L
Chr9_10L:117977551..117977575 21/25 Sense off-target caskin1.L
Chr4L:60730893..60730917 21/25 unknown
Chr5L:124779993..124780017 21/25 unknown
Chr8L:67429069..67429093 21/25 unknown
tropicalis 10.0 Chr10:17973113..17973137 25/25 Antisense target adam11
Chr8:125180712..125180736 22/25 unknown
Publications
First: ADAM11 a novel regulator of Wnt and BMP4 signaling in neural crest and cancer., Front Cell Dev Biol 2023                        
Most recent:
View All Papers