Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-29209010

Morpholino Name: adam11 MO2
Synonyms: MO11spl
Target mRNA: adam11

Morpholino Type: splice blocking morpholino
Sequence: 5' CCAATGGAGGCATAGTGGCACTG 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 23/23 22/23
genome
MO
5' CAGTGCCACTATGCCTCCATTGG 3'
   |||||||||||||||||||||||
3' GTCACGGTGATACGGAGGTAACC 5'
5' CAGTGCTACTATGCCTCCATTGG 3'
   |||||| ||||||||||||||||
3' GTCACGGTGATACGGAGGTAACC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:5541291..5541313 23/23 Antisense target adam11.L
Chr9_10S:5235765..5235787 22/23 Antisense target adam11.S
Chr2L:30852986..30853008 20/23 Sense off-target abr.L
Chr5L:128530897..128530919 19/23 Antisense off-target slc9a9.L
Chr1L:75138875..75138897 19/23 Sense off-target LOC108710540
Chr3S:127784485..127784507 20/23 unknown
Chr5L:81062681..81062703 19/23 unknown
Chr9_10L:133116910..133116932 19/23 unknown
Chr9_10L:1687834..1687856 19/23 unknown
tropicalis 10.0 Chr3:97885760..97885782 19/23 Sense off-target tjp1
Chr2:108520214..108520236 20/23 unknown
Chr1:133679498..133679520 19/23 unknown
Chr5:111757160..111757182 19/23 unknown
Publications
First: ADAM11 a novel regulator of Wnt and BMP4 signaling in neural crest and cancer., Front Cell Dev Biol 2023                        
Most recent:
View All Papers