Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-29209096

Morpholino Name: usp12b MO1
Synonyms:
Target mRNA: usp12b

Morpholino Type: uncategorized morpholino
Sequence: 5' CGATGTTTCTGACAGTCATTTAGTT 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
tropicalis 10.0 Chr2:63139967..63139991 21/25 Antisense off-target kif21b
Publications
First: The USP46 complex deubiquitylates LRP6 to promote Wnt/β-catenin signaling., Nat Commun 2023                                  
Most recent:
View All Papers