Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-29209157

Morpholino Name: scn1a MO1
Synonyms:
Target mRNA: scn1a

Morpholino Type: translation blocking morpholino
Sequence: 5' TTACTGCTTTGCTACTTTCATAATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 23/25 25/25
genome
MO
5' CATTATGAAAGGAGCTAAGCAGTAA 3'
   ||||||||||| ||| |||||||||
3' GTAATACTTTCATCGTTTCGTCATT 5'
5' CATTATGAAAGTAGCAAAGCAGTAA 3'
   |||||||||||||||||||||||||
3' GTAATACTTTCATCGTTTCGTCATT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10S:64923361..64923385 25/25 Antisense target scn1a.S
Chr9_10L:74037709..74037733 22/25 Antisense off-target LOC108701357
Chr9_10S:59931408..59931432 21/25 Antisense off-target neb.S
Chr5S:5247556..5247580 21/25 unknown
tropicalis 10.0 Chr9:69938768..69938792 23/25 Antisense target scn1a
Chr8:84659158..84659182 21/25 unknown
Publications
First: Characterization of Na+ currents regulating intrinsic excitability of optic tectal neurons., Life Sci Alliance 2024                          
Most recent:
View All Papers