Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-29209158

Morpholino Name: scn2a MO1
Synonyms:
Target mRNA: scn2a

Morpholino Type: translation blocking morpholino
Sequence: 5' GTGGTTGCTCCATCTTCTCATCC 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10S:64600109..64600131 23/23 Antisense off-target LOC108702974
Chr9_10L:73640057..73640079 22/23 Antisense off-target LOC108701352
Chr6L:17834084..17834106 20/23 unknown
tropicalis 10.0 Chr9:70466617..70466639 22/23 Antisense off-target scn3a
Chr5:6145603..6145625 19/23 Sense off-target alk
Chr9:84807972..84807994 19/23 Antisense off-target myo10.2
Chr9:84807972..84807994 19/23 Antisense off-target LOC116407773
Chr4:40418913..40418935 19/23 unknown
Publications
First: Characterization of Na+ currents regulating intrinsic excitability of optic tectal neurons., Life Sci Alliance 2024                          
Most recent:
View All Papers