Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-29209453

Morpholino Name: elk1 MO2
Synonyms:
Target mRNA: elk1

Morpholino Type: translation blocking morpholino
Sequence: 5' (GGTCATTTTACTTTGTCCTGTCCCT 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
Publications
First: BRCA1 and ELK-1 regulate neural progenitor cell fate in the optic tectum in response to visual experience in Xenopus laevis tadpoles., Proc Natl Acad Sci U S A 2024                          
Most recent:
View All Papers