Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-29209477

Morpholino Name: septin7 MO1
Synonyms:
Target mRNA: septin7

Morpholino Type: splice blocking morpholino
Sequence: 5' TGCTGTAGAGTCAGTGCCTCGCCTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 24/25 25/25
genome
MO
5' AAGGCGAGGCACAGACTCTACAGCA 3'
   |||||||||||| ||||||||||||
3' TTCCGCTCCGTGACTGAGATGTCGT 5'
5' AAGGCGAGGCACTGACTCTACAGCA 3'
   |||||||||||||||||||||||||
3' TTCCGCTCCGTGACTGAGATGTCGT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:68130649..68130673 25/25 Antisense target septin7.L
Chr6S:3486850..3486874 22/25 unknown
Chr6S:54896463..54896487 22/25 unknown
tropicalis 10.0 Chr6:64139927..64139951 24/25 Antisense target septin7
Publications
First: PCP and Septins govern the polarized organization of the actin cytoskeleton during convergent extension., Curr Biol 2024                  
Most recent:
View All Papers