Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-9
Mature Sequence: UCUUUGGUUAUCUAGCUGUAUG
Full Sequence:
miRBase:
In Situ Images:

NF Stage 26

NF Stage 26

NF Stage 34

NF Stage 36

NF Stage 45

NF Stage 45

Cited Literature:
MicroRNA-9 reveals regional diversity of neural progenitors along the anterior-posterior axis.
Bonev B et al. 2011