Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions
XB-LINE-2354

Line Name: Xtr.rxrbem2Horb


Summary
Synonym:
Species: Xenopus tropicalis
Background Strain: Xtr.Nigerian1NXR
Paternal Line:
Maternal Line:
Description: CRISPR knockout of rxrb (retinoid X receptor beta). Confirmed germline transmission. Animals carry a 1 base pair insertion. Contact the NXR for more details.
Phenotype Description: +1 base pair mutation sequence GGCCTACACCCTGTTAGCTCCTCTGA(A)GGATGTGAAG.
Color Morph: pigmented
Breeding Type: OUTBRED
Lab of Origin: NXR
Line Type: Mutant
Mutated Gene(s): rxrb
MTA Required: No
Public: Yes
Catalogue Number: NXR_3233

Stock Center RRID Generation Availability Mutant Details
NXR (US) NXR_3233 F2+ Order
EXRC (Europe)
NBRP (Japan)
XLRRI (US)

Back to Search Lines