Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions
XB-LINE-1840

Line Name: Xtr.nr2f2emNXR


Summary
Synonym:
Species: Xenopus tropicalis
Background Strain: Xtr.Nigerian1NXR
Paternal Line:
Maternal Line:
Description: CRISPR knockout for nr2f2 (nuclear receptor subfamily 2 group F member 2 ). Germ line transmission confirmed. Animals carry a 1 base pair insertion. Custom line generated for Prof. Oliver Wessely. Contact NXR for more details.
Phenotype Description: +1 base pair mutation sequence AGCAGCAGCAGCACATCGAG(T)TGCGTGGTGTGCG. Associated with human 46,XX sex reversal 5.
Color Morph: pigmented
Breeding Type: OUTBRED
Lab of Origin: NXR
Line Type: Mutant
Mutated Gene(s): nr2f2
MTA Required: No
Public: Yes
Catalogue Number: NXR_3139

Stock Center RRID Generation Availability Mutant Details
NXR (US) NXR_3139 F1 Order
EXRC (Europe)
NBRP (Japan)
XLRRI (US)

Back to Search Lines